Review



gapdh forward  (Merck & Co)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Merck & Co gapdh forward
    Gapdh Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc12281364__mmc2-633-236-239?v=Merck+%26+Co
    Average 86 stars, based on 1 article reviews
    gapdh forward - by Bioz Stars, 2026-07
    86/100 stars

    Images



    Similar Products

    gapdh forward primer 5 caaggccgagaatggga 3  (Eurofins)
    86
    Eurofins gapdh forward primer 5 caaggccgagaatggga 3
    Gapdh Forward Primer 5 Caaggccgagaatggga 3, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc12629924-82-0-7?v=Eurofins
    Average 86 stars, based on 1 article reviews
    gapdh forward primer 5 caaggccgagaatggga 3 - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    gapdh sangon biotech forward  (Sangon Biotech)
    86
    Sangon Biotech gapdh sangon biotech forward
    Gapdh Sangon Biotech Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc12303055__mmc1-5-6-7?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    gapdh sangon biotech forward - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    gapdh forward  (Merck & Co)
    86
    Merck & Co gapdh forward
    Gapdh Forward, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc12281364__mmc2-633-236-239?v=Merck+%26+Co
    Average 86 stars, based on 1 article reviews
    gapdh forward - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    gapdh forward primer  (Thermo Fisher)
    90
    Thermo Fisher gapdh forward primer
    Gapdh Forward Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc12217163-350-29-51?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    gapdh forward primer - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    phosphate dehydrogenase gapdh forward primer  (Thermo Fisher)
    99
    Thermo Fisher phosphate dehydrogenase gapdh forward primer
    Phosphate Dehydrogenase Gapdh Forward Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pm40408475-365-31-58?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    phosphate dehydrogenase gapdh forward primer - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier
    glyceraldehyde 3 phosphate dehydrogenase gapdh forward primer  (Thermo Fisher)
    99
    Thermo Fisher glyceraldehyde 3 phosphate dehydrogenase gapdh forward primer
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Forward Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc12101492-315-23-45?v=Thermo+Fisher
    Average 99 stars, based on 1 article reviews
    glyceraldehyde 3 phosphate dehydrogenase gapdh forward primer - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier
    gapdh forward primer  (Qiagen)
    90
    Qiagen gapdh forward primer
    Gapdh Forward Primer, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pm40073150-85-11-23?v=Qiagen
    Average 90 stars, based on 1 article reviews
    gapdh forward primer - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    mouse gapdh primer (forward sequence: catcactgccacccagaagactg)  (Bioneer Corporation)
    90
    Bioneer Corporation mouse gapdh primer (forward sequence: catcactgccacccagaagactg)
    Mouse Gapdh Primer (Forward Sequence: Catcactgccacccagaagactg), supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pm39799744-57-34-49?v=Bioneer+Corporation
    Average 90 stars, based on 1 article reviews
    mouse gapdh primer (forward sequence: catcactgccacccagaagactg) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    gapdh forward, 5’-ctgggctacactgagcacc-3’, reverse, 5’-aagtggtcgttgagggcaatg-3  (Thermo Fisher)
    90
    Thermo Fisher gapdh forward, 5’-ctgggctacactgagcacc-3’, reverse, 5’-aagtggtcgttgagggcaatg-3
    Gapdh Forward, 5’ Ctgggctacactgagcacc 3’, Reverse, 5’ Aagtggtcgttgagggcaatg 3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc11772837-37-15-5?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    gapdh forward, 5’-ctgggctacactgagcacc-3’, reverse, 5’-aagtggtcgttgagggcaatg-3 - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    h- gapdh forward 5′-gcaaattccatggcaccgt-3′  (Sangon Biotech)
    90
    Sangon Biotech h- gapdh forward 5′-gcaaattccatggcaccgt-3′

    H Gapdh Forward 5′ Gcaaattccatggcaccgt 3′, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gapdh+forward/pmc11866518-97-0-5?v=Sangon+Biotech
    Average 90 stars, based on 1 article reviews
    h- gapdh forward 5′-gcaaattccatggcaccgt-3′ - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: Cell Reports Medicine

    Article Title: A genome-wide association study identified PRKCB as a causal gene and therapeutic target for Mycobacterium avium complex disease

    doi: 10.1016/j.xcrm.2024.101923

    Figure Lengend Snippet:

    Article Snippet: h- GAPDH forward 5′-GCAAATTCCATGGCACCGT-3′ , Sangon Biotech , N/A.

    Techniques: Virus, Recombinant, Modification, Magnetic Beads, Protease Inhibitor, Western Blot, Reporter Assay, Gene Expression, Generated, Plasmid Preparation, Software